Polyurethane sponges bearing cucurbituril adsorb Cr(III) and Pb(II) ions from contaminated water samples.

Water contamination with toxic metals causes harmful effects on the environment and to human health. Although cucurbiturils have carboxyl groups in their portal that can interact with metal ions, there is a lack of studies about their use as metal adsorbent. This scenario has motivated conduction of the present study, which addresses the use of cucurbit[6]uril (CB[6]) and cucurbit[8]uril (CB[8]) for adsorbing Pb and Cr from water samples, in free forms and immobilized in poly(urethane) sponges. The adsorption kinetics revealed that CB[8] leads to faster adsorption compared to CB[6], with equilibrium achieved in 8 h for CB[8] and 48 h for CB[6] for both metals, and achieved up to 80% of decrease in metal concentration. The Langmuir isotherm model provided a better description of adsorption for Cr and Pb in CB[6] and Pb in CB[8] with a maximum concentration adsorbed of 32.47 mg g-1 for Pb in CB[6], while the Dubinin-Radushkevich model was more suitable for Cr adsorption in CB[8]. Sponges containing CB[6] and CB[8] have proven to be efficient for Pb and Cr remediation in tannery effluent samples, reducing Cr and Pb concentration by 42 and 33%, respectively. The results indicate that CB[6] and CB[8], whether used in their pure form or integrated into sponges, exhibit promising potential for efficiently adsorbing metals in aqueous contaminated environments.

Comparative Genomic Analysis of PEBP Genes in Cucurbits Explores the Interactors of Cucumber CsPEBPs Related to Flowering Time.

The family of phosphatidylethanolamine-binding proteins (PEBPs) participates in various plant biological processes, mainly flowering regulation and seed germination. In cucurbit crops, several PEBP genes have been recognized to be responsible for flowering time. However, the investigation of PEBP family members across the genomes of cucurbit species has not been reported, and their conservation and divergence in structure and function remain largely unclear. Herein, PEBP genes were identified from seven cucurbit crops and were used to perform a comparative genomics analysis. The cucurbit PEBP proteins could be classified into MFT, FT, TFL, and PEBP clades, and further, the TFL clade was divided into BFT-like, CEN-like, and TFL1-like subclades. The MFT-like, FT-like, and TFL-like proteins were clearly distinguished by a critical amino acid residue at the 85th position of the Arabidopsis FT protein. In gene expression analysis, CsaPEBP1 was highly expressed in flowers, and its expression levels in females and males were 70.5 and 89.2 times higher, respectively, than those in leaves. CsaPEBP5, CsaPEBP6, and CsaPEBP7 were specifically expressed in male flowers, with expression levels 58.1, 17.3, and 15.7 times higher, respectively, than those of leaves. At least five CsaPEBP genes exhibited the highest expression during the later stages of corolla opening. Through clustering of time-series-based RNA-seq data, several potential transcription factors (TFs) interacting with four CsaPEBPs were identified during cucumber corolla opening. Because of the tandem repeats of binding sites in promoters, NF-YB (Csa4G037610) and GATA (Csa7G64580) TFs appeared to be better able to regulate the CsaPEBP2 and CsaPEBP5 genes, respectively. This study would provide helpful information for further investigating the roles of PEBP genes and their interacting TFs in growth and development processes, such as flowering time regulation in cucurbit crops.

Construction of an Artificial Light-Harvesting System with Photocatalytic Activity Based on Nor-seco-cucurbit[10]uril in Aqueous Solution.

A supramolecular assembly was constructed based on the tetraphenylethylene derivatives (TPEs) and nor-seco-cucurbit[10]uril (ns-Q[10]). Upon introduction of the dye Rhodamine B (RB) into the TPEs@ns-Q[10] assembly, an energy transfer process can occur from the TPEs@ns-Q[10] assembly to RB. Moreover, after the addition of Nile Red (NiR), a two-step sequential energy transfer process from the TPEs@ns-Q[10] assembly to RB and then to NiR can occur. Additionally, the dye Eosin Y (ESY) was introduced into the TPEs@ns-Q[10] assembly and an energy transfer process can take place from the TPEs@ns-Q[10] assembly to ESY. To utilize the harvested energy from the TPEs@ns-Q[10]-RB-NiR and TPEs@ns-Q[10]-ESY system, we applied the TPEs@ns-Q[10] assembly-based light-harvesting systems (LHSs) as a catalyst for the advancement of the photocatalytic dehalogenation reaction in aqueous solution. When promoted with 0.5 mol % catalyst, the reaction yield reached 78 and 68%, demonstrating the promising potential of TPEs@ns-Q[10] assembly-based LHSs in the promotion of the photocatalytic dehalogenation reaction.

Thermal Transitions and Structural Characteristics of Poly(3,4-ethylenedioxythiophene/cucurbit[7]uril) Polypseudorotaxane and Polyrotaxane Thin Films.

Herein, we report the thermal transitions and structural properties of poly(3,4-ethylenedioxythiophene/cucurbit[7]uril) pseudopolyrotaxane (PEDOT∙CB7-PS) and polyrotaxane (PEDOT∙CB7-PR) thin films compared with those of pristine PEDOT. The structural characteristics were investigated by using variable-temperature spectroscopic ellipsometry (VTSE), differential scanning calorimetry (DSC), X-ray diffraction (XRD) and atomic force microscopy (AFM). VTSE and DSC results indicated the presence of an endothermic process and glass transition in the PEDOT∙CB7-PS and PEDOT∙CB7-PR thin films. X-ray diffraction of PEDOT∙CB7-PS and PEDOT∙CB7-PR powders displayed the presence of interchain π-π stacking revealing a characteristic arrangement of aromatic rings in the internal structure of the crystallites. AFM imaging of PEDOT∙CB7-PS and PEDOT∙CB7-PR thin films exhibited significant differences in the surface topographies compared with those of PEDOT. A high degree of crystallization was clearly visible on the surface of the PEDOT layer, whereas the PEDOT∙CB7-PS and PEDOT∙CB7-PR thin films exhibited more favorable surface parameters. Such significant differences identified in the surface morphology of the investigated layers can, therefore, be clearly associated with the presence of surrounding CB7 on PEDOT skeletons.

First report of cucurbit yellow vine disease caused by Serratia marcescens on cucurbit crops in Iowa.

Cucurbit yellow vine disease (CYVD) is caused by Serratia marcescens, vectored by squash bugs (Anasa tristis), and is an emerging disease in many parts of the U.S. CYVD can cause 100% yield losses in cucurbits (Bruton et al., 2003). In the summer of 2021, at the Iowa State University Horticultural Research Station (HRS) in Gilbert, Iowa, we observed leaf yellowing, vine decline, and honey-brown discoloration of the phloem of acorn squash (Cucurbita pepo cv. Table Ace) plants in research fields that were infested with squash bugs. In 2022, we observed similar symptoms on pumpkin (Cucurbita maxima cv. Howden) and muskmelon (Cucumis melo cv. Athena) in different fields at the HRS and on giant pumpkins (Cucurbita maxima cv. Prizewinner) in Jones and Ringgold counties. For up to 3 symptomatic plants of each cucurbit species per location, a 20-cm-long stem section immediately above the soil line was excised, surface sterilized by immersion in 10% sodium hypochlorite and 70% ethanol for 2 min each, then triple rinsed in sterile water. The interior of the cross-section tissue was blotted on Luria agar amended with cycloheximide (100 µg/ml) and tetracycline (20 µg/ml) (Stock et al. 2003). Whitish translucent colonies developed after incubation at 28°C for 48 h. The genomic DNA of three isolates from symptomatic plants of muskmelon (MK01), pumpkin (HFP01), and giant pumpkin (AP01), was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD). S. marcescens species-specific primers YV1 (5'-GGGACTTGCTCCCCGG-3') and YV4 (5'-AACGTCAATTGATGAACGTATTAAGT-3') (Bruton et al. 2003) were used to amplify part of the 16S rDNA gene, and the primers specific to S. marcescens CYVD strains A79F/A79R (Zhang et al., 2005) were used to amplify part of a major facilitatory superfamily (MFS) transporter gene strain. The sequences of the 16S rRNA PCR product for the three isolates were identical and were deposited in NCBI under Accession OR963533. They shared 100% (395/395 nt) identity with other CYVD strains (Rascoe et al. 2003) and those of other S. marcescens strains in NCBI. The sequences of the amplified region of the MFS transporter gene of the three isolates (NCBI Accession OR962261) were identical and showed a 98.8% (319/323 nt) identity to that of non-CYVD-causing S. marcescens strains, such as N10A28 (Accession CP033623.1). Koch's postulates were fulfilled by inoculating C. pepo cv. Zephyr plants with either strain HFP01 or phosphate buffer saline (PBS) (10 plants per treatment) 1 wk after seeding by injecting 300 µl of bacteria (~108 CFU/ml) or PBS using a syringe needle. Plants were incubated at 28°C in a growth room for 4 wks. CYVD symptoms similar to those observed in the field developed on 7 out of 10 plants inoculated with strain HFP01 in one study, and 9 out 10 plants in a replicate study, with none of the PBS-inoculated plants showing CYVD symptoms. Bacteria were isolated from the symptomatic plants with selection on tetracycline. The PCR fragments amplified with YV1/YV4 and A79F/A79R were the same size as those of the pre-inoculation strain HFP01. To our knowledge this is the first report of CYVD in Iowa and in the Upper Midwest of the U.S. CYVD is a devastating disease that poses a significant threat to cucurbit production. This report can serve as an alert for the region's growers and for the development of effective management practices.

Supramolecular Genome Editing: Targeted Delivery and Endogenous Activation of CRISPR/Cas9 by Dynamic Host-Guest Recognition.

We synthesize supramolecular poly(disulfide) (CPS) containing covalently attached cucurbit[7]uril (CB[7]), which is exploited not only as a carrier to deliver plasmid DNA encoding destabilized Cas9 (dsCas9), but also as a host to include trimethoprim (TMP) by CB[7] moieties through the supramolecular complexation to form TMP@CPS/dsCas9. Once the plasmid is transfected into tumor cells by CPS, the presence of polyamines can competitively trigger the decomplexation of TMP@CPS, thereby displacing and releasing TMP from CB[7] to stabilize dsCas9 that can target and edit the genomic locus of PLK1 to inhibit the growth of tumor cells. Following the systemic administration of TMP@CPS/dsCas9 decorated with hyaluronic acid (HA), tumor-specific editing of PLK1 is detected due to the elevated polyamines in tumor microenvironment, greatly minimizing off-target editing in healthy tissues and non-targeted organs. As the metabolism of polyamines is dysregulated in a wide range of disorders, this study offers a supramolecular approach to precisely control CRISPR/Cas9 functions under particular pathological contexts.

Virulence-Related Assays for Investigation of the Acidovorax citrulli-Cucurbitaceae Pathosystem.

Acidovorax citrulli is one of the most important pathogens of cucurbit crops, mainly melon and watermelon. Although A. citrulli is able to infect all aerial parts of the plant, fruits are highly sensitive to the bacterium. Therefore, the disease is known as bacterial fruit blotch (BFB). The unavailability of effective tools for managing BFB, including the lack of resistant varieties, exacerbates the threat this disease poses to the cucurbit industry. However, despite the economic importance of BFB, still little is known about basic aspects of A. citrulli-plant interactions. Here, we present diverse techniques that have recently been developed for investigation of basic aspects of BFB, including identification of virulence determinants of the pathogen.

Utilizing symmetrical tetramethyl cucurbit[6]uril-based supramolecular fluorescence probe for detection of paraquat in water.

A supramolecular fluorescence probe has been developed using a symmetrical tetramethyl cucurbit[6]uril (TMeQ[6]) and a styryl derivative (SPy) with a host-guest ratio of 2:1. The introduction of paraquat (PQ) competes with SPy for the TMeQ[6] cavity, resulting in fluorescent quenching. The addition of 17 common herbicides and ions had negligible effects on the fluorescence quenching, indicating that the 2TMeQ[6]/SPy complex exhibits excellent selectivity in detecting PQ. The detection limit was found to be 4.62 × 10-7 M. More importantly, the probe was engineered to detect paraquat in river water by examining post-treatment samples and noting alterations in fluorescence color. The red to blue (R/B) intensity ratio is subsequently calculated to ascertain the PQ concentration. Experimental trials conducted on river water samples yielded recovery rates between 98.21 % and 108 %, with a relative standard deviation of less than 5 %. By pairing this with a smartphone-based colorimetric analysis application, we can facilitate portable PQ detection, enabling efficient and convenient monitoring across various locations.

Evidence for the natural infection of cucurbit chlorotic yellows virus (CCYV) in lettuce plants from India.

In the years 2021 and 2022, lettuce plants showing blistering, chlorosis, mosaic, rosetting/ excess proliferation, and stunting symptoms were subjected to leaf-dip transmission electron microscopy, RT-PCR followed by sequence analysis and bio-assay to unfold the identity of associated virus(es). The association of long filamentous virions (~ 850 nm in length) as seen through leaf-dip transmission electron microscopy suggested the possible infection by a potyvirus or crinivirus, either singly or in combination. RT-PCR assays using generic primers targeting the RdRp region of criniviruses and the NIb region of potyviruses revealed the association of both a crinivirus as well as a potyvirus. The gel-purified RT-PCR products derived from the RdRp region of criniviruses upon cloning, sequencing, and NCBI BLAST analysis indicated the associated crinivirus as cucurbit chlorotic yellows virus (CCYV). Further, RT-PCR assays using specific primers targeting CP and CP minor genes of CCYV followed by cloning and sequencing confirmed its association with the diseased lettuce plants. Besides, the bioassay based on whitefly-mediated virus transmission followed by RT-PCR confirmed the infectivity of CCYV from diseased to healthy lettuce plants. The results of this study confirmed the natural infection of CCYV in lettuce host for the first time in the world indicating its distribution across the crop families.

N-Methyl- and N-Phenylpiperazine Functionalized Styryl Dyes Inside Cucurbiturils: Theoretical Assessment of the Factors Governing the Host-Guest Recognition.

The family of cucurbiturils (CBs), the unique pumpkin-shaped macrocycles, has received great attention over the past four decades owing to their remarkable recognition properties. They have found diverse applications including biosensing and drug delivery technologies. The cucurbituril complexation of guest molecules can modulate their pKas, improve their solubility in aqueous solution, and reduce the adverse effects of the drugs, as well as enhance the stability and/or enable targeted delivery of the drug molecule. Employing twelve cationic styryl dyes with N-methyl- and N-phenylpiperazine functionality as probes, we attempted to understand the factors that govern the host-guest complexation of such molecules within CB[7] and CB[8] host systems. Various key factors determining the process were recognized, such as the pH and dielectric constant of the medium, the cavity size of the host, the chemical characteristics of the substituents in the guest entity, and the presence/absence of metal cations. The presented results add to our understanding (at the molecular level) of the mechanism of encapsulation of styryl dyes by cucurbiturils, thus shedding new light on various aspects of the intriguing complexation chemistry and the underlying recognition processes.

Further Molecular Diagnosis Determines Lack of Evidence for Real Seed Transmission of Tomato Leaf Curl New Delhi Virus in Cucurbits.

Begomoviruses (family Geminiviridae) cause serious diseases in many crop families. Since 2013, the Spanish isolate of tomato leaf curl New Delhi virus (ToLCNDV) has been a limiting factor for cucurbits production in the Mediterranean basin, forcing farmers to adapt new management and control techniques. Although it is well-known that begomoviruses are naturally transmitted by the whitefly Bemisia tabaci, the capacity of these viruses to be vertically transmitted through seeds remains controversial. Clarifying the potential ToLCNDV seed transmission is essential to understand the epidemiology of this threating-for-cucurbits virus and to design appropriate control strategies. We assessed ToLCNDV distribution in the leaves, flowers and seeds of the infected plants of susceptible Cucumis melo accessions and toleration to the infected genotypes of Cucurbita moschata by conventional and quantitative PCR. We analyzed whether the viral particle was transmitted to offspring. We also evaluated ToLCNDV presence in commercial seeds of cucurbits (zucchini (Cucurbita pepo), melon (C. melo), cucumber (Cucumis sativus) and watermelon (Citrullus lanatus)) and in their progenies. As the assayed seedlings remained symptomless, we increased the reliability and accuracy of detection in these samples by searching for replicative forms of ToLCNDV by combining Southern blot hybridization and rolling-circle amplification (RCA). However, integral genomic DNA was not identified in the plants of offspring. Although the seedborne nature of ToLCNDV was confirmed, our results do not support the transmission of this virus from contaminated seeds to progeny.

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

A Cucurbit[8]uril-Based Supramolecular Framework Material for Reversible Iodine Capture in the Vapor Phase and Solution.

The safe and efficient management of hazardous radioactive iodine is significant for nuclear waste reprocessing and environmental industries. A novel supramolecular framework compound based on cucurbit[8]uril (Q[8]) and 4-aminopyridine (4-AP) is reported in this paper. In the single crystal structure of Q[8]-(4-AP), two 4-AP molecules interact with the outer surface of Q[8] and the two other 4-AP molecules are encapsulated into the Q[8] cavity to form the self-assembly Q[8]-(4-AP). Iodine adsorption experiments show that the as-prepared Q[8]-(4-AP) not only has a high adsorption capacity (1.74 g· g-1 ) for iodine vapor but also can remove the iodine in the organic solvent and the aqueous solution with the removal efficiencies of 95% and 91%, respectively. The presence of a large number of hydrogen bonds between the iodine molecule and the absorbent, as seen in the single crystal structure of iodine-loaded Q[8]-(4-AP) (I2 @Q[8]-(4-AP)), is thought to be responsible for the exceptional iodine adsorption capacity of the material. In addition, the adsorption-desorption tests reveal that the self-assembly material has no significant loss of iodine capture capacity after five cycles, indicating that it has sufficient reusability.

First Report of Cucurbit aphid-borne yellows virus infecting five cucurbits in India.

Cucurbits are among the most popular vegetables cultivated globally. They have high economic importance, especially in India, where they are cooked and eaten as vegetables (Dhillon et al. 2016). In February 2023, yellowing symptoms were observed on cucurbitaceous species, viz. Trichosanthes cucumerina (Snake gourd - SG), Luffa acutangula (Ridge gourd - RG), Lagenaria siceraria (Bottle gourd - BG), Luffa aegyptiaca (Sponge gourd - SPG) and yellow chlorotic spots were recorded on Benincasa hispida (Ash gourd - AG) growing in the experimental farm at the Indian Agricultural Research Institute, Regional Station, Pune (Supplementary Figure 1). The average disease incidence ranged from 5% to 30%. A total of 175 leaf samples, including thirty symptomatic and five asymptomatic plants of each cucurbit, were collected and tested by DAS-ELISA using antisera against cucurbit aphid-borne yellows virus (CABYV) (DSMZ, Germany), cucurbit yellow stunting disorder virus (CYSDV) (Arsh Biotech, India), cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), and papaya ringspot virus (PRSV) (Agdia, USA). All 150 symptomatic cucurbit samples tested positive for CABYV, while five samples from SG, 14 from RG, two from AG, and 11 from SPG hosts were also positive for PRSV. Asymptomatic samples were negative for all viruses tested. In order to further confirm the presence of the virus, total RNA was extracted from ten samples of each cucurbit host that were positive only for CABYV and the asymptomatic samples using the RNeasy Plant Mini Kit (Qiagen, Germany) as per the manufacturer's protocol. Two-step RT-PCR was carried out using the extracted RNA and CABYV-specific primers, amplifying c. 484 bp of the coat protein gene region (Boubourakas et al. 2006). Amplicons of expected size were obtained in all symptomatic samples, whereas the asymptomatic samples tested negative. Three amplicons obtained from positive samples from each of the cucurbit species were directly sequenced and found to be identical to each other. A representative virus sequence obtained from each cucurbit was deposited in GenBank (Snake gourd - OQ921128, Ridge gourd - OQ921127, Bottle gourd - OQ921126, Ash gourd - OQ921125, Sponge gourd - OQ921129). In BLASTn analysis, the isolates shared from 94.23 to 100% nucleotide identities with the Indian CABYV isolates of various cucurbits and clustered closely with other Pune isolates in the phylogenetic analysis (Supplementary Figure 2). CABYV (genus Polerovirus) is a single-stranded positive-sense RNA virus, and is known to infect and cause severe economic losses in cucurbits worldwide. Previously, occurrences of CABYV have been reported in cucurbits such as watermelon, bitter gourd, cucumber, squash, teasel gourd, and muskmelon in India (Nagendran et al. 2022; Tripathi et al. 2023). It has also been reported to infect a weed species - Abelmoschus moschatus from the same geographical region (Verma et al. 2023). To our knowledge, this is the first report of the natural occurrence of CABYV in snake gourd and ridge gourd worldwide and bottle gourd, ash gourd and sponge gourd in India. The present findings have significant epidemiological importance, as they demonstrate that CABYV is spreading to other cucurbits and occurring widely in India.

Photo-Controlled Nano-Supramolecular Size and Reversible Luminescent Behaviors Based on Cucurbit[7]uril Cascaded Assembly.

Supramolecular luminescent material with switchable behavior and photo-induced aggregation with emission enhancement is a current research hot spot. Herein, a size-tunable nano-supramolecular assembly with reversible photoluminescent behavior was constructed by noncovalent polymerization of diarylethene-bridged bis(coumarin) derivative (DAE-CO), cucurbit[7]uril (CB[7]), and ß-cyclodextrin-grafted hyaluronic acid (HACD). Benefiting from the macrocyclic confinement effect, the guest molecule DAE-CO was included into the cavity of CB[7] to give enhanced fluorescence emission of the resulting DAE-CO⊂CB[7]2 with longer lifetime at 432 nm to 1.43 ns, thereby further enhancing fluorescence output and lifetime (1.46 ns) when further assembled with HACD, compared with the free DAE-CO (0.95 ns). In addition, DAE-CO, DAE-CO⊂CB[7]2, and DAE-CO⊂CB[7]2&HACD all possessed characteristics of aggregation-induced emission and reversible photo-switched structural interconversion, exhibiting an obvious photophysical activation phenomenon of self-aggregation into larger nanoparticles with increase in fluorescence emission intensity, lifetime, and size after irradiation, which could be increased step by step with the alternating irradiation of 254 nm (5 min) or >600 nm (30 s) repeated 7 times. These supramolecular assemblies were successfully used in the tumor cells' targeted imaging and anti-counterfeiting because of the capability of HACD for recognizing specific receptors overexpressed on the surface of tumor cells and the excellent photo-regulated switch ability of DAE-CO, providing an approach of constructing photo-induced emission-enhanced luminescent materials.

Molecular identification and development of an infectious cDNA clone of Trichosanthes kirilowii-infecting cucurbit mild mosaic virus.

Trichosanthes kirilowii has been mainly grown for use in traditional Chinese medicine. In this study, cucurbit mild mosaic virus (CuMMV) belonging to the genus Fabavirus was identified from T. kirilowii plants. CuMMV possesses a segmented, bipartite linear single-stranded RNA genome composed of RNA1 and RNA2. Sequence analysis showed that each genomic segment shares the highest sequence similarity with those of CuMMV isolated from pumpkin. A full-length infectious cDNA clone of CuMMV was further constructed and was found to induce typical symptoms in T. kirilowii, Cucumis sativus, C. melo, Citrullus lanatus, and Cucurbita pepo. The sap inoculum derived from the infectious cDNA clone of CuMMV could be mechanically transmitted and reproduce similar symptoms in the tested plants. This is the first report on the construction of a biologically active, full-length infectious cDNA clone of CuMMV, which will provide a useful tool in understanding CuMMV-encoded proteins and plant-CuMMV interactions.

Acyclic Cucurbit[n]urils: Effective Taste Masking Nanocontainers for Cationic Bitter Compounds.

New acyclic cucurbit[n]urils (ACBs) with eight carboxylate groups were synthesized. These hosts are highly soluble in water, and can form stable inclusion complexes with cationic bitter compounds. ACBs are confirmed to be non-toxic and biocompatible. Two-bottle preference (TBP) tests on mice show that all ACBs are tasteless to mammals. ACBs are discovered to mask the bitterness of berberine and denatonium benzoate, but not quinine hydrochloride, due to different binding modes.

Compartment-specific 129Xe HyperCEST z spectroscopy and chemical shift imaging of cucurbit[6]uril in spontaneously breathing rats.

129Xe hyperpolarized gas chemical exchange saturation transfer (HyperCEST) MRI has been suggested as molecular imaging modality but translation to in vivo imaging has been slow, likely due to difficulties of synthesizing suitable molecules. Cucurbit[6]uril-either in readily available non-functionalized or potentially in functionalized form-may, combined with 129Xe HyperCEST MRI, prove useful as a switchable 129Xe MR contrast agent but the likely differential properties of contrast generation in individual chemical compartments as well as the influence of 129Xe signal drifts encountered in vivo on HyperCEST MRI are unknown. Here, HyperCEST z spectroscopy and chemical shift imaging with compartment-specific analysis are performed in a total of 10 rats using cucurbit[6]uril injected i.v. and under a protocol employing spontaneous respiration. Differences in intensity of the HyperCEST effect between chemical compartments and anatomical regions are investigated. Strategies to mitigate influence of signal instabilities associated with drifts in physiological parameters are developed. It is shown that presence of cucurbit[6]uril can be readily detected under spontaneous 129Xe inhalation mostly in aqueous tissues further away from the lung. Differences of effect intensity in individual regions and compartments must be considered in HyperCEST data interpretation. In particular, there seems to be almost no effect in lipids. 129Xe HyperCEST MR measurements utilizing spontaneous respiration protocols and extended measurement times are feasible. HyperCEST MRI of non-functionalized cucurbit[6]uril may create contrast between anatomical structures in vivo.

Cucurbit[6]uril Hyperpolarized Chemical Exchange Saturation Transfer Pulse Sequence Parameter Optimization and Detectability Limit Assessment at 3.0T.

Molecular imaging is the future of personalized medicine; however, it requires effective contrast agents. Hyperpolarized chemical exchange saturation transfer (HyperCEST) can boost the signal of Hyperpolarized 129 Xe MRI and render it a molecular imaging modality of high efficiency. Cucurbit[6]uril (CB6) has been successfully employed in vivo as a contrast agent for HyperCEST MRI, however its performance in a clinical MRI scanner has yet to be optimized. In this study, MRI pulse sequence parameter optimization was first performed in CB6 solutions in phosphate-buffered saline (PBS), and subsequently in whole sterile citrated bovine blood. The performance of four different depolarization pulse shapes (sinusoidal, 3-lobe sinc (3LS), rectangular (block), and hyperbolic secant (hypsec) was optimized. The detectability limits of CB6 in a clinical 3.0T MRI scanner was assessed using the optimized pulse sequences. The 3LS depolarization pulses performed best, and demonstrated 24 % depletion in a 25 µM solution of CB6 in PBS. It performed similarly in blood. The CB6 detectability limit was found to be 100 µM in citrated bovine blood with a correspondent HyperCEST depletion of 30 % ±9 %. For the first time, the HP 129 Xe HyperCEST effect was observed in red blood cells (RBC) and had a similar strength as HyperCEST in plasma.

A Fluorescent Unnatural Mannosamine Derivative with Enhanced Emission Upon Complexation with Cucurbit[7]uril.

Metabolic incorporation of unnatural functionality on glycans has allowed chemical biologists to observe and affect cellular processes. Recent work has resulted in glycan-fluorophore structures that allow for direct visualization of glycan-mediated processes, shining light on their role in living systems. This work describes the serendipitous discovery of a small chemical reporter-fluorophore. Investigations into the mechanism of fluorescence arising from (trimethylsilyl)methylglycine appended on mannosamine suggest rigidity and restriction of lone pair geometry contribute to the fluorescent behaviour. In fact, in situ cyclization and encapsulation in cucurbit[7]uril enhance fluorescence to levels that can be observed in live cells. While the reported unnatural mannosamine does not traverse the sialic acid biosynthetic pathway, this discovery may lead to small, "turn-on" chemical reporters for incorporation in living systems.